![]() |
![]() |
![]() |
![]() |
Overview
This tutorial demonstrates the tfio.genome
package that provides commonly used genomics IO functionality--namely reading several genomics file formats and also providing some common operations for preparing the data (for example--one hot encoding or parsing Phred quality into probabilities).
This package uses the Google Nucleus library to provide some of the core functionality.
Setup
try:
%tensorflow_version 2.x
except Exception:
pass
!pip install -q tensorflow-io
import tensorflow_io as tfio
import tensorflow as tf
FASTQ Data
FASTQ is a common genomics file format that stores both sequence information in addition to base quality information.
First, let's download a sample fastq
file.
# Download some sample data:
curl -OL https://raw.githubusercontent.com/tensorflow/io/master/tests/test_genome/test.fastq
% Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 407 100 407 0 0 2035 0 --:--:-- --:--:-- --:--:-- 2035
Read FASTQ Data
Now, let's use tfio.genome.read_fastq
to read this file (note a tf.data
API coming soon).
fastq_data = tfio.genome.read_fastq(filename="test.fastq")
print(fastq_data.sequences)
print(fastq_data.raw_quality)
tf.Tensor( [b'GATTACA' b'CGTTAGCGCAGGGGGCATCTTCACACTGGTGACAGGTAACCGCCGTAGTAAAGGTTCCGCCTTTCACT' b'CGGCTGGTCAGGCTGACATCGCCGCCGGCCTGCAGCGAGCCGCTGC' b'CGG'], shape=(4,), dtype=string) tf.Tensor( [b'BB>B@FA' b'AAAAABF@BBBDGGGG?FFGFGHBFBFBFABBBHGGGFHHCEFGGGGG?FGFFHEDG3EFGGGHEGHG' b'FAFAF;F/9;.:/;999B/9A.DFFF;-->.AAB/FC;9-@-=;=.' b'FAD'], shape=(4,), dtype=string)
As you see, the returned fastq_data
has fastq_data.sequences
which is a string tensor of all sequences in the fastq file (which can each be a different size) along with fastq_data.raw_quality
which includes Phred encoded quality information about the quality of each base read in the sequence.
Quality
You can use a helper op to convert this quality information into probabilities if you are interested.
quality = tfio.genome.phred_sequences_to_probability(fastq_data.raw_quality)
print(quality.shape)
print(quality.row_lengths().numpy())
print(quality)
WARNING:tensorflow:From /tmpfs/src/tf_docs_env/lib/python3.6/site-packages/tensorflow/python/util/deprecation.py:574: calling map_fn_v2 (from tensorflow.python.ops.map_fn) with dtype is deprecated and will be removed in a future version. Instructions for updating: Use fn_output_signature instead (4, None, 1) [ 7 68 46 3] <tf.RaggedTensor [[[0.0005011872854083776], [0.0005011872854083776], [0.0012589251855388284], [0.0005011872854083776], [0.0007943279924802482], [0.00019952621369156986], [0.0006309572490863502]], [[0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.00019952621369156986], [0.0007943279924802482], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.0003162277571391314], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.0001584893325343728], [0.00012589251855388284], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0006309572490863502], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.00012589251855388284], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00019952621369156986], [0.00012589251855388284], [0.00012589251855388284], [0.0003981070767622441], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.00019952621369156986], [0.00012589251855388284], [0.0002511885541025549], [0.0003162277571391314], [0.0001584893325343728], [0.015848929062485695], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00012589251855388284], [0.0002511885541025549], [0.0001584893325343728], [0.00012589251855388284], [0.0001584893325343728]], [[0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.002511885715648532], [0.00019952621369156986], [0.03981072083115578], [0.003981071058660746], [0.002511885715648532], [0.050118714570999146], [0.003162277629598975], [0.03981072083115578], [0.002511885715648532], [0.003981071058660746], [0.003981071058660746], [0.003981071058660746], [0.0005011872854083776], [0.03981072083115578], [0.003981071058660746], [0.0006309572490863502], [0.050118714570999146], [0.0003162277571391314], [0.00019952621369156986], [0.00019952621369156986], [0.00019952621369156986], [0.002511885715648532], [0.06309572607278824], [0.06309572607278824], [0.0012589251855388284], [0.050118714570999146], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.03981072083115578], [0.00019952621369156986], [0.0003981070767622441], [0.002511885715648532], [0.003981071058660746], [0.06309572607278824], [0.0007943279924802482], [0.06309572607278824], [0.001584893325343728], [0.002511885715648532], [0.001584893325343728], [0.050118714570999146]], [[0.00019952621369156986], [0.0006309572490863502], [0.0003162277571391314]]]>
One hot encodings
You may also want to encode the genome sequence data (which consists of A
T
C
G
bases) using a one hot encoder. There's a built in operation that can help with this.
one_hot = tfio.genome.sequences_to_onehot(fastq_data.sequences)
print(one_hot)
print(one_hot.shape)
<tf.RaggedTensor [[[0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0]]]> (4, None, 4)
print(tfio.genome.sequences_to_onehot.__doc__)
Convert DNA sequences into a one hot nucleotide encoding. Each nucleotide in each sequence is mapped as follows: A -> [1, 0, 0, 0] C -> [0, 1, 0, 0] G -> [0 ,0 ,1, 0] T -> [0, 0, 0, 1] If for some reason a non (A, T, C, G) character exists in the string, it is currently mapped to a error one hot encoding [1, 1, 1, 1]. Args: sequences: A tf.string tensor where each string represents a DNA sequence Returns: tf.RaggedTensor: The output sequences with nucleotides one hot encoded.