This page was translated by the Cloud Translation API.
Switch to English

টেনসরফ্লো.আর.জে দেখুন গুগল কোলাবে চালান গিটহাবের উত্স দেখুন নোটবুক ডাউনলোড করুন

সংক্ষিপ্ত বিবরণ

এই টিউটোরিয়ালটি tfio.genome প্যাকেজটি দেখায় যা সাধারণত ব্যবহৃত জিনোমিক্স IO কার্যকারিতা সরবরাহ করে - যথা: বেশ কয়েকটি জেনোমিক্স ফাইল ফর্ম্যাটগুলি পড়া এবং ডেটা প্রস্তুত করার জন্য কিছু সাধারণ ক্রিয়াকলাপ সরবরাহ করা (উদাহরণস্বরূপ - একটি হট এনকোডিং বা ফ্রেড গুণমানকে সম্ভাবনার মধ্যে পার্স করা)।

এই প্যাকেজটি কয়েকটি মূল কার্যকারিতা সরবরাহ করতে গুগল নিউক্লিয়াস লাইব্রেরি ব্যবহার করে।

সেটআপ

 try:
  %tensorflow_version 2.x
except Exception:
  pass
!pip install -q tensorflow-io
 
 import tensorflow_io as tfio
import tensorflow as tf
 

FASTQ ডেটা

FASTQ একটি সাধারণ জিনোমিক্স ফাইল ফর্ম্যাট যা বেস মানের মানের তথ্য ছাড়াও উভয় ক্রম তথ্য সংরক্ষণ করে।

প্রথমে আসুন একটি নমুনা fastq ফাইল ডাউনলোড করুন।

 # Download some sample data:
!curl -OL https://raw.githubusercontent.com/tensorflow/io/master/tests/test_genome/test.fastq
 
  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed
100   407  100   407    0     0   1850      0 --:--:-- --:--:-- --:--:--  1841

FASTQ ডেটা পড়ুন

এখন, এই ফাইলটি পড়ার জন্য tfio.genome.read_fastq ব্যবহার করা যাক (শিগগিরই একটি tf.data এপিআই আসবে নোট করুন)।

 fastq_data = tfio.genome.read_fastq(filename="test.fastq")
print(fastq_data.sequences)
print(fastq_data.raw_quality)
 
tf.Tensor(
[b'GATTACA'
 b'CGTTAGCGCAGGGGGCATCTTCACACTGGTGACAGGTAACCGCCGTAGTAAAGGTTCCGCCTTTCACT'
 b'CGGCTGGTCAGGCTGACATCGCCGCCGGCCTGCAGCGAGCCGCTGC' b'CGG'], shape=(4,), dtype=string)
tf.Tensor(
[b'BB>B@FA'
 b'AAAAABF@BBBDGGGG?FFGFGHBFBFBFABBBHGGGFHHCEFGGGGG?FGFFHEDG3EFGGGHEGHG'
 b'FAFAF;F/9;.:/;999B/9A.DFFF;-->.AAB/FC;9-@-=;=.' b'FAD'], shape=(4,), dtype=string)

যেমনটি আপনি দেখতে পেয়েছেন, ফিরে fastq_data fastq_data.sequences fastq_datafastq_data.sequences যা ফাস্টিক ফাইলের সমস্ত সিকোয়েন্সের স্ট্রিং টেনসর (যা প্রতিটি আলাদা আকারের হতে পারে) পাশাপাশি fastq_data.raw_quality প্রতিটি বেসের গুণমান সম্পর্কে ফ্রেড এনকোডেড মানের তথ্য অন্তর্ভুক্ত করে ক্রম অনুসারে।

গুণ

আপনি যদি আগ্রহী হন তবে এই গুণমানের তথ্যটিকে সম্ভাব্যতায় রূপান্তর করতে আপনি কোনও সহায়ক বিকল্প ব্যবহার করতে পারেন।

 quality = tfio.genome.phred_sequences_to_probability(fastq_data.raw_quality)
print(quality.shape)
print(quality.row_lengths().numpy())
print(quality)
 
(4, None, 1)
[ 7 68 46  3]
<tf.RaggedTensor [[[0.0005011872854083776], [0.0005011872854083776], [0.0012589251855388284], [0.0005011872854083776], [0.0007943279924802482], [0.00019952621369156986], [0.0006309572490863502]], [[0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.00019952621369156986], [0.0007943279924802482], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.0003162277571391314], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.0001584893325343728], [0.00012589251855388284], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0006309572490863502], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.00012589251855388284], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00019952621369156986], [0.00012589251855388284], [0.00012589251855388284], [0.0003981070767622441], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.00019952621369156986], [0.00012589251855388284], [0.0002511885541025549], [0.0003162277571391314], [0.0001584893325343728], [0.015848929062485695], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00012589251855388284], [0.0002511885541025549], [0.0001584893325343728], [0.00012589251855388284], [0.0001584893325343728]], [[0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.002511885715648532], [0.00019952621369156986], [0.03981072083115578], [0.003981071058660746], [0.002511885715648532], [0.050118714570999146], [0.003162277629598975], [0.03981072083115578], [0.002511885715648532], [0.003981071058660746], [0.003981071058660746], [0.003981071058660746], [0.0005011872854083776], [0.03981072083115578], [0.003981071058660746], [0.0006309572490863502], [0.050118714570999146], [0.0003162277571391314], [0.00019952621369156986], [0.00019952621369156986], [0.00019952621369156986], [0.002511885715648532], [0.06309572607278824], [0.06309572607278824], [0.0012589251855388284], [0.050118714570999146], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.03981072083115578], [0.00019952621369156986], [0.0003981070767622441], [0.002511885715648532], [0.003981071058660746], [0.06309572607278824], [0.0007943279924802482], [0.06309572607278824], [0.001584893325343728], [0.002511885715648532], [0.001584893325343728], [0.050118714570999146]], [[0.00019952621369156986], [0.0006309572490863502], [0.0003162277571391314]]]>

একটি গরম এনকোডিং

আপনি একটি হট এনকোডার ব্যবহার করে জিনোম সিকোয়েন্স ডেটা (যা A T C G ঘাঁটি সমন্বিত) এনকোড করতে চাইতে পারেন। একটি বিল্ট ইন অপারেশন রয়েছে যা এটির সাথে সহায়তা করতে পারে।

 one_hot = tfio.genome.sequences_to_onehot(fastq_data.sequences)
print(one_hot)
print(one_hot.shape)
 
<tf.RaggedTensor [[[0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0]]]>
(4, None, 4)

 print(tfio.genome.sequences_to_onehot.__doc__)
 
Convert DNA sequences into a one hot nucleotide encoding.

  Each nucleotide in each sequence is mapped as follows:
  A -> [1, 0, 0, 0]
  C -> [0, 1, 0, 0]
  G -> [0 ,0 ,1, 0]
  T -> [0, 0, 0, 1]

  If for some reason a non (A, T, C, G) character exists in the string, it is
  currently mapped to a error one hot encoding [1, 1, 1, 1].

  Args:
    sequences: A tf.string tensor where each string represents a DNA sequence

  Returns:
    tf.RaggedTensor: The output sequences with nucleotides one hot encoded.