Bu sayfa, Cloud Translation API ile çevrilmiştir.
Switch to English

TensorFlow.org üzerinde görüntüle Google Colab'da yayınla Kaynağı GitHub'da görüntüle Not defterini indir

genel bakış

Bu eğitici, yaygın olarak kullanılan genomik IO işlevselliğini sağlayan - yani birkaç genomik dosya biçimini okuyan ve ayrıca verileri hazırlamak için bazı ortak işlemler sağlayan tfio.genome paketini gösterir (örneğin, bir sıcak kodlama veya Phred kalitesini olasılıklara ayrıştırma).

Bu paket, temel işlevlerden bazılarını sağlamak için Google Nucleus kitaplığını kullanır.

Kurmak

 try:
  %tensorflow_version 2.x
except Exception:
  pass
!pip install -q tensorflow-io
 
 import tensorflow_io as tfio
import tensorflow as tf
 

FASTQ Verileri

FASTQ, temel kalite bilgilerine ek olarak her iki sekans bilgisini de saklayan yaygın bir genomik dosya formatıdır.

Önce örnek bir fastq dosyası fastq .

 # Download some sample data:
!curl -OL https://raw.githubusercontent.com/tensorflow/io/master/tests/test_genome/test.fastq
 
  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed
100   407  100   407    0     0   1850      0 --:--:-- --:--:-- --:--:--  1841

FASTQ Verilerini Oku

Şimdi bu dosyayı okumak için tfio.genome.read_fastq (yakında bir tf.data API'sine dikkat edin).

 fastq_data = tfio.genome.read_fastq(filename="test.fastq")
print(fastq_data.sequences)
print(fastq_data.raw_quality)
 
tf.Tensor(
[b'GATTACA'
 b'CGTTAGCGCAGGGGGCATCTTCACACTGGTGACAGGTAACCGCCGTAGTAAAGGTTCCGCCTTTCACT'
 b'CGGCTGGTCAGGCTGACATCGCCGCCGGCCTGCAGCGAGCCGCTGC' b'CGG'], shape=(4,), dtype=string)
tf.Tensor(
[b'BB>B@FA'
 b'AAAAABF@BBBDGGGG?FFGFGHBFBFBFABBBHGGGFHHCEFGGGGG?FGFFHEDG3EFGGGHEGHG'
 b'FAFAF;F/9;.:/;999B/9A.DFFF;-->.AAB/FC;9-@-=;=.' b'FAD'], shape=(4,), dtype=string)

Gördüğünüz gibi, döndürülen fastq_data , fastq_data.sequences dosyasındaki (her biri farklı bir boyutta olabilir) tüm dizilerin dize tensörü ve fastq_data.raw_quality ile birlikte her bir tabanın kalitesi hakkında fastq_data.raw_quality kodlanmış kalite bilgisi içeren fastq_data.raw_quality sahiptir. sırayla.

Kalite

Eğer ilgileniyorsanız bu kalite bilgilerini olasılıklara dönüştürmek için bir yardımcı op kullanabilirsiniz.

 quality = tfio.genome.phred_sequences_to_probability(fastq_data.raw_quality)
print(quality.shape)
print(quality.row_lengths().numpy())
print(quality)
 
(4, None, 1)
[ 7 68 46  3]
<tf.RaggedTensor [[[0.0005011872854083776], [0.0005011872854083776], [0.0012589251855388284], [0.0005011872854083776], [0.0007943279924802482], [0.00019952621369156986], [0.0006309572490863502]], [[0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.00019952621369156986], [0.0007943279924802482], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.0003162277571391314], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.0001584893325343728], [0.00012589251855388284], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0006309572490863502], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.00012589251855388284], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00019952621369156986], [0.00012589251855388284], [0.00012589251855388284], [0.0003981070767622441], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.00019952621369156986], [0.00012589251855388284], [0.0002511885541025549], [0.0003162277571391314], [0.0001584893325343728], [0.015848929062485695], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00012589251855388284], [0.0002511885541025549], [0.0001584893325343728], [0.00012589251855388284], [0.0001584893325343728]], [[0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.002511885715648532], [0.00019952621369156986], [0.03981072083115578], [0.003981071058660746], [0.002511885715648532], [0.050118714570999146], [0.003162277629598975], [0.03981072083115578], [0.002511885715648532], [0.003981071058660746], [0.003981071058660746], [0.003981071058660746], [0.0005011872854083776], [0.03981072083115578], [0.003981071058660746], [0.0006309572490863502], [0.050118714570999146], [0.0003162277571391314], [0.00019952621369156986], [0.00019952621369156986], [0.00019952621369156986], [0.002511885715648532], [0.06309572607278824], [0.06309572607278824], [0.0012589251855388284], [0.050118714570999146], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.03981072083115578], [0.00019952621369156986], [0.0003981070767622441], [0.002511885715648532], [0.003981071058660746], [0.06309572607278824], [0.0007943279924802482], [0.06309572607278824], [0.001584893325343728], [0.002511885715648532], [0.001584893325343728], [0.050118714570999146]], [[0.00019952621369156986], [0.0006309572490863502], [0.0003162277571391314]]]>

Bir sıcak kodlama

Ayrıca, bir sıcak kodlayıcı kullanarak genom dizisi verilerini ( A T C G bazlarından oluşur) kodlamak isteyebilirsiniz. Bu konuda yardımcı olabilecek yerleşik bir işlem var.

 one_hot = tfio.genome.sequences_to_onehot(fastq_data.sequences)
print(one_hot)
print(one_hot.shape)
 
<tf.RaggedTensor [[[0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0]]]>
(4, None, 4)

 print(tfio.genome.sequences_to_onehot.__doc__)
 
Convert DNA sequences into a one hot nucleotide encoding.

  Each nucleotide in each sequence is mapped as follows:
  A -> [1, 0, 0, 0]
  C -> [0, 1, 0, 0]
  G -> [0 ,0 ,1, 0]
  T -> [0, 0, 0, 1]

  If for some reason a non (A, T, C, G) character exists in the string, it is
  currently mapped to a error one hot encoding [1, 1, 1, 1].

  Args:
    sequences: A tf.string tensor where each string represents a DNA sequence

  Returns:
    tf.RaggedTensor: The output sequences with nucleotides one hot encoded.