이 페이지는 Cloud Translation API를 통해 번역되었습니다.
Switch to English

TensorFlow.org에서보기 Google Colab에서 실행 GitHub에서 소스보기 노트북 다운로드

개요

이 학습서에서는 일반적으로 사용되는 genomics IO 기능 (예 : 여러 게놈 파일 형식 읽기 및 데이터 준비를위한 일부 공통 조작 (예 : 핫 인코딩 또는 Phred 품질을 확률로 구문 분석))을 제공하는 tfio.genome 패키지를 보여줍니다.

이 패키지는 Google Nucleus 라이브러리를 사용하여 일부 핵심 기능을 제공합니다.

설정

 try:
  %tensorflow_version 2.x
except Exception:
  pass
!pip install -q tensorflow-io
 
 import tensorflow_io as tfio
import tensorflow as tf
 

FASTQ 데이터

FASTQ는 염기 서열 정보와 함께 염기 서열 정보를 모두 저장하는 일반적인 게놈 파일 형식입니다.

먼저 샘플 fastq 파일을 다운로드하겠습니다.

 # Download some sample data:
!curl -OL https://raw.githubusercontent.com/tensorflow/io/master/tests/test_genome/test.fastq
 
  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed
100   407  100   407    0     0   1850      0 --:--:-- --:--:-- --:--:--  1841

FASTQ 데이터 읽기

이제 tfio.genome.read_fastq 를 사용 tfio.genome.read_fastq 파일을 읽 tfio.genome.read_fastq (곧 tf.data API에 주목).

 fastq_data = tfio.genome.read_fastq(filename="test.fastq")
print(fastq_data.sequences)
print(fastq_data.raw_quality)
 
tf.Tensor(
[b'GATTACA'
 b'CGTTAGCGCAGGGGGCATCTTCACACTGGTGACAGGTAACCGCCGTAGTAAAGGTTCCGCCTTTCACT'
 b'CGGCTGGTCAGGCTGACATCGCCGCCGGCCTGCAGCGAGCCGCTGC' b'CGG'], shape=(4,), dtype=string)
tf.Tensor(
[b'BB>B@FA'
 b'AAAAABF@BBBDGGGG?FFGFGHBFBFBFABBBHGGGFHHCEFGGGGG?FGFFHEDG3EFGGGHEGHG'
 b'FAFAF;F/9;.:/;999B/9A.DFFF;-->.AAB/FC;9-@-=;=.' b'FAD'], shape=(4,), dtype=string)

보시다시피, 반환 된 fastq_data 에는 fastq_data.sequences 가 있으며, fastq 파일의 모든 시퀀스의 문자열 텐서 (각각 다른 크기 일 수 있음)와 fastq_data.raw_quality 각 기본 읽기의 품질에 대한 Phred 인코딩 된 품질 정보 포함) 순서대로.

품질

원하는 경우 도우미 op를 사용하여이 품질 정보를 확률로 변환 할 수 있습니다.

 quality = tfio.genome.phred_sequences_to_probability(fastq_data.raw_quality)
print(quality.shape)
print(quality.row_lengths().numpy())
print(quality)
 
(4, None, 1)
[ 7 68 46  3]
<tf.RaggedTensor [[[0.0005011872854083776], [0.0005011872854083776], [0.0012589251855388284], [0.0005011872854083776], [0.0007943279924802482], [0.00019952621369156986], [0.0006309572490863502]], [[0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.00019952621369156986], [0.0007943279924802482], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.0003162277571391314], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.0001584893325343728], [0.00012589251855388284], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0005011872854083776], [0.00019952621369156986], [0.0006309572490863502], [0.0005011872854083776], [0.0005011872854083776], [0.0005011872854083776], [0.00012589251855388284], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00019952621369156986], [0.00012589251855388284], [0.00012589251855388284], [0.0003981070767622441], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.0010000000474974513], [0.00019952621369156986], [0.0001584893325343728], [0.00019952621369156986], [0.00019952621369156986], [0.00012589251855388284], [0.0002511885541025549], [0.0003162277571391314], [0.0001584893325343728], [0.015848929062485695], [0.0002511885541025549], [0.00019952621369156986], [0.0001584893325343728], [0.0001584893325343728], [0.0001584893325343728], [0.00012589251855388284], [0.0002511885541025549], [0.0001584893325343728], [0.00012589251855388284], [0.0001584893325343728]], [[0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.0006309572490863502], [0.00019952621369156986], [0.002511885715648532], [0.00019952621369156986], [0.03981072083115578], [0.003981071058660746], [0.002511885715648532], [0.050118714570999146], [0.003162277629598975], [0.03981072083115578], [0.002511885715648532], [0.003981071058660746], [0.003981071058660746], [0.003981071058660746], [0.0005011872854083776], [0.03981072083115578], [0.003981071058660746], [0.0006309572490863502], [0.050118714570999146], [0.0003162277571391314], [0.00019952621369156986], [0.00019952621369156986], [0.00019952621369156986], [0.002511885715648532], [0.06309572607278824], [0.06309572607278824], [0.0012589251855388284], [0.050118714570999146], [0.0006309572490863502], [0.0006309572490863502], [0.0005011872854083776], [0.03981072083115578], [0.00019952621369156986], [0.0003981070767622441], [0.002511885715648532], [0.003981071058660746], [0.06309572607278824], [0.0007943279924802482], [0.06309572607278824], [0.001584893325343728], [0.002511885715648532], [0.001584893325343728], [0.050118714570999146]], [[0.00019952621369156986], [0.0006309572490863502], [0.0003162277571391314]]]>

하나의 핫 인코딩

또한, (구성 게놈 서열 데이터를 인코딩 할 수 A T C G 한 핫 인코더를 사용하여 염기). 이를 도울 수있는 기본 제공 작업이 있습니다.

 one_hot = tfio.genome.sequences_to_onehot(fastq_data.sequences)
print(one_hot)
print(one_hot.shape)
 
<tf.RaggedTensor [[[0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1], [1, 0, 0, 0], [1, 0, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 0, 1], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 0, 1, 0], [0, 0, 0, 1], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [1, 0, 0, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 0, 1], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 1, 0], [1, 0, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 1, 0, 0], [0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0]], [[0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 1, 0]]]>
(4, None, 4)

 print(tfio.genome.sequences_to_onehot.__doc__)
 
Convert DNA sequences into a one hot nucleotide encoding.

  Each nucleotide in each sequence is mapped as follows:
  A -> [1, 0, 0, 0]
  C -> [0, 1, 0, 0]
  G -> [0 ,0 ,1, 0]
  T -> [0, 0, 0, 1]

  If for some reason a non (A, T, C, G) character exists in the string, it is
  currently mapped to a error one hot encoding [1, 1, 1, 1].

  Args:
    sequences: A tf.string tensor where each string represents a DNA sequence

  Returns:
    tf.RaggedTensor: The output sequences with nucleotides one hot encoded.